Keep Talking and Nobody Explodes

Keep Talking and Nobody Explodes

Ikke nok vurderinger
DNA Mutation
   
Pris
Føj til foretrukne
Gjort til foretrukken
Fjern som foretrukken
Modules: Regular Module
Filstørrelse:
Offentliggjort:
Opdateret:
2.136 MB
19. dec. 2020 kl. 9:35
25. nov. 2021 kl. 18:48
4 ændringsbemærkninger ( vis )

Abonner for at downloade
DNA Mutation

I 1 samling af BigCrunch
The Full KTaNE Experience (REMAKE) [Part 1]
997 genstande
Beskrivelse
"GATCGATTCGATCGATGCTAGC…"

Idea - Serum
Implementer - BigCrunch22

TP Supported!

If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.
1 kommentarer
Serum 9. mar. 2021 kl. 13:09 
Hey! I cant believe you made my idea come true, this is awesome!